Creation
Adam Rutherford
Verkauft von Rarewaves.com USA, London, LONDO, Vereinigtes Königreich
AbeBooks-Verkäufer seit 11. Juni 2025
Neu - Softcover
Zustand: Neu
Versand von Vereinigtes Königreich nach USA
Anzahl: 1 verfügbar
In den Warenkorb legenVerkauft von Rarewaves.com USA, London, LONDO, Vereinigtes Königreich
AbeBooks-Verkäufer seit 11. Juni 2025
Zustand: Neu
Anzahl: 1 verfügbar
In den Warenkorb legenCreation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on SundayThe Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.'A superbly written explanation' Brian CoxThis same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer'The perfect primer on the past and future of DNA' Guardian'Susenseful, erudite and thrilling' Prospect'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial.
Bestandsnummer des Verkäufers LU-9780241954690
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
„Über diesen Titel“ kann sich auf eine andere Ausgabe dieses Titels beziehen.
Wenn Sie Verbraucher sind, können Sie gemäß den folgenden Bestimmungen vom Vertrag zurücktreten. Verbraucher ist jede natürliche Person, die zu Zwecken handelt, die nicht ihrer kaufmännischen, gewerblichen, künstlerischen oder beruflichen Tätigkeit zugerechnet werden können.
Informationen zum Widerrufsrecht
Gesetzliches Widerrufsrecht
Sie haben das Recht, den Vertrag innerhalb von 14 Tagen ohne Angabe von Gründen zu widerrufen.
Die Widerrufsfrist beträgt 14 Tage ab dem Tag, an dem Sie oder ein von Ihnen benannter Dritter, der nicht der Transporteur ist, die letzte Ware oder den letzten Posten oder das letzte Exemplar in Besitz genommen hat.
Um das Widerrufsrecht auszuüben, füllen Sie auf unserer Website unter „Meine Einkäufe" in „Mein Nutzerkonto" eine eindeutige Erklärung elektronisch aus und senden Sie sie ab. Wir werden Ihnen unverzüglich eine Bestätigung über den Eingang eines solchen Widerrufs auf einem dauerhaften Datenträger (z. B. per E-Mail) übermitteln.
Um die Widerrufsfrist einzuhalten, reicht es aus, dass Sie Ihre Mitteilung über die Ausübung des Widerrufsrechts vor Ablauf der Widerrufsfrist absenden.
Auswirkungen des Widerrufs
Wenn Sie diesen Vertrag widerrufen, erstatten wir Ihnen alle Zahlungen, die wir von Ihnen erhalten haben, einschließlich der Lieferkosten (mit Ausnahme der zusätzlichen Kosten, die entstehen, wenn Sie eine andere Art der Lieferung als die von uns angebotene günstigste Standardlieferung gewählt haben).
Wir können einen Abzug von der Rückerstattung für den Wertverlust der gelieferten Waren vornehmen, wenn der Verlust auf eine unnötige Behandlung durch Sie zurückzuführen ist.
Wir werden die Rückerstattung unverzüglich und nicht später als 14 Tage nach dem Tag vornehmen, an dem wir über Ihre Entscheidung, diesen Vertrag zu widerrufen, informiert wurden.
Für die Rückerstattung verwenden wir dasselbe Zahlungsmittel, das Sie für die ursprüngliche Transaktion verwendet haben, es sei denn, Sie haben ausdrücklich etwas anderes vereinbart; in keinem Fall werden Ihnen aufgrund einer solchen Rückerstattung Gebühren berechnet.
Wir können die Rückzahlung verweigern, bis wir die Waren wieder zurückerhalten haben oder Sie den Nachweis erbracht haben, dass Sie die Waren zurückgesandt haben, je nachdem, was eher eintritt.
Sie müssen die Waren unverzüglich und in jedem Fall spätestens 14 Tage ab dem Tag, an dem Sie uns über den Widerruf dieses Vertrags unterrichten, an Rarewaves.com USA, London, London, United Kingdom, zurücksenden oder übergeben. Die Frist ist eingehalten, wenn Sie die Ware vor Ablauf der Frist von 14 Tagen zurücksenden. Sie müssen die direkten Kosten der Rücksendung der Waren tragen. Sie haften nur für einen etwaigen Wertverlust der Waren, der auf eine Behandlung zurückzuführen ist, die nicht zur Prüfung der Art, Eigenschaften und Funktionsweise der Waren erforderlich ist.
Ausnahmen vom Widerrufsrecht
Das Widerrufsrecht gilt nicht für:
Please note that we do not offer Priority shipping to any country.
We currently do not ship to the below countries:
Russia
Belarus
Ukraine
Israel
Please do not attempt to place orders with any of these countries as a ship to address - they will be cancelled.
| Bestellmenge | 7 bis 12 Werktage | 7 bis 12 Werktage |
|---|---|---|
| Erster Artikel | EUR 0.00 | EUR 0.00 |
Die Versandzeiten werden von den Verkäuferinnen und Verkäufern festgelegt. Sie variieren je nach Versanddienstleister und Standort. Sendungen, die den Zoll passieren, können Verzögerungen unterliegen. Eventuell anfallende Abgaben oder Gebühren sind von der Käuferin bzw. dem Käufer zu tragen. Die Verkäuferin bzw. der Verkäufer kann Sie bezüglich zusätzlicher Versandkosten kontaktieren, um einen möglichen Anstieg der Versandkosten für Ihre Artikel auszugleichen.