Vectors tools study normal (13 Ergebnisse)

Sprache: Englisch
Verlag: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
- Hardcover
Anbieter: Ammareal, Morangis, FrankreichAmmareal
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Sehr gut
EUR 5,57
EUR 16,50 VersandVersand von Frankreich nach USAAnzahl: 1 verfügbar
Hardcover. Zustand: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations….

- Softcover
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes KönigreichRia Christie Collections
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 116,63
EUR 14,00 VersandVersand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. In.

Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Softcover
Anbieter: Romtrade Corp., STERLING HEIGHTS, MI, USARomtrade Corp.
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 131,00
Versand gratisVersand innerhalb von USAAnzahl: 1 verfügbar
Zustand: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.

- Softcover
Anbieter: Basi6 International, Irving, TX, USABasi6 International
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 131,42
Versand gratisVersand innerhalb von USAAnzahl: 1 verfügbar
Zustand: Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.

- Softcover
Anbieter: Books Puddle, New York, NY, USABooks Puddle
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Neu
EUR 147,29
EUR 3,42 VersandVersand innerhalb von USAAnzahl: 4 verfügbar
Zustand: New. pp. viii + 477.

- Softcover
Anbieter: Books Puddle, New York, NY, USABooks Puddle
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 156,58
EUR 3,42 VersandVersand innerhalb von USAAnzahl: 1 verfügbar
Zustand: Used. pp. 475 1st Edition.

- Softcover
Anbieter: Majestic Books, Hounslow, Vereinigtes KönigreichMajestic Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 162,17
EUR 7,60 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 475.

- Softcover
Anbieter: Revaluation Books, Exeter, Vereinigtes KönigreichRevaluation Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 156,34
EUR 14,61 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 2 verfügbar
Paperback. Zustand: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.

- Softcover
Anbieter: moluna, Greven, Deutschlandmoluna
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 118,64
EUR 48,99 VersandVersand von Deutschland nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.

- Softcover
Anbieter: Biblios, frankfurt am main, HESSE, DeutschlandBiblios
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 167,73
EUR 9,95 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 475.

Sprache: Englisch
Verlag: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Softcover
Anbieter: AHA-BUCH GmbH, Einbeck, DeutschlandAHA-BUCH GmbH
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 146,51
EUR 64,17 VersandVersand von Deutschland nach USAAnzahl: 2 verfügbar
Taschenbuch. Zustand: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is tr…iggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .

- Softcover
- Print-on-Demand
Anbieter: Majestic Books, Hounslow, Vereinigtes KönigreichMajestic Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Neu
EUR 151,02
EUR 7,60 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 4 verfügbar
Zustand: New. Print on Demand pp. viii + 477 100 Figures.

- Softcover
- Print-on-Demand
Anbieter: Biblios, frankfurt am main, HESSE, DeutschlandBiblios
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Neu
EUR 154,68
EUR 9,95 VersandVersand von Deutschland nach USAAnzahl: 4 verfügbar
Zustand: New. PRINT ON DEMAND pp. viii + 477.