Gesamtpreis (1 Artikel Artikel):
Versandziel:
vectors tools study normal (14 Ergebnisse)
Direkt zu den wichtigsten Suchergebnissen
Suchfilter
Produktart
- Alle Product Types
- Bücher (14)
- Magazine & Zeitschriften (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Comics (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Noten (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Kunst, Grafik & Poster (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Fotografien (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Karten (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Manuskripte & Papierantiquitäten (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
Zustand Mehr dazu
- Neu (9)
- Wie Neu, Sehr Gut oder Gut Bis Sehr Gut (1)
- Gut oder Befriedigend (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Ausreichend oder Schlecht (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Wie beschrieben (4)
Einband
Weitere Eigenschaften
- Erstausgabe (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Signiert (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Schutzumschlag (Keine weiteren Ergebnisse entsprechen dieser Verfeinerung)
- Angebotsfoto (3)
- Keine Print-on-Demand Angebote (12)
Sprache (1)
Gratisversand
Land des Verkäufers
Verkäuferbewertung
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Sprache: Englisch
Verlag: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
SonderangebotEUR 5,01
EUR 16,50 Versand
Versand von Frankreich nach USAAnzahl: 1 verfügbar
In den WarenkorbHardcover. Zustand: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato ASI Subseries H:, 34)
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes Königreich
Verkäuferbewertung 5 von 5 Sternen
EUR 114,33
EUR 13,83 Versand
Versand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
In den WarenkorbZustand: New. In.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Basi6 International, Irving, TX, USA
Verkäuferbewertung 5 von 5 Sternen
Zustand: Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Romtrade Corp., STERLING HEIGHTS, MI, USA
Verkäuferbewertung 5 von 5 Sternen
Zustand: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
-
![Bild des Verkäufers für Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34 zum Verkauf von Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein](https://pictures.abebooks.com/inventory/md/md30732786818.jpg)
Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34
Sprache: Englisch
Verlag: Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Anbieter: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, Deutschland
Verkäuferbewertung 5 von 5 Sternen
gr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
-
Zustand: New. pp. viii + 477.
-
Zustand: Used. pp. 475 1st Edition.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato Asi Series (Closed) / Nato Asi Subseries H: (Closed))
Anbieter: Revaluation Books, Exeter, Vereinigtes Königreich
Verkäuferbewertung 5 von 5 Sternen
EUR 155,66
EUR 14,43 Versand
Versand von Vereinigtes Königreich nach USAAnzahl: 2 verfügbar
In den WarenkorbPaperback. Zustand: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Sprache: Englisch
Verlag: Springer Berlin Heidelberg, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
EUR 118,64
EUR 48,99 Versand
Versand von Deutschland nach USAAnzahl: Mehr als 20 verfügbar
In den WarenkorbZustand: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Biblios, Frankfurt am main, HESSE, Deutschland
Verkäuferbewertung 4 von 5 Sternen
Zustand: Used. pp. 475.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Majestic Books, Hounslow, Vereinigtes Königreich
Verkäuferbewertung 4 von 5 Sternen
EUR 175,08
EUR 7,50 Versand
Versand von Vereinigtes Königreich nach USAAnzahl: 1 verfügbar
In den WarenkorbZustand: Used. pp. 475.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Sprache: Englisch
Verlag: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
Anbieter: AHA-BUCH GmbH, Einbeck, Deutschland
Verkäuferbewertung 5 von 5 Sternen
Taschenbuch. Zustand: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Majestic Books, Hounslow, Vereinigtes Königreich
Verkäuferbewertung 4 von 5 Sternen
EUR 150,68
EUR 7,50 Versand
Versand von Vereinigtes Königreich nach USAAnzahl: 4 verfügbar
In den WarenkorbZustand: New. Print on Demand pp. viii + 477 100 Figures.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Anbieter: Biblios, Frankfurt am main, HESSE, Deutschland
Verkäuferbewertung 4 von 5 Sternen
Zustand: New. PRINT ON DEMAND pp. viii + 477.
